11823   Galt     Status: ES cell colonies screened / QC no positives

GeneGalt
Chromosome4
Deletion Start41,755,631
Deletion End41,758,608
Deletion Size2,978
Genome Build38
MGI IDMGI:95638
NCBI Gene ID14430
BAC ID235L9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableNo

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF41,756,00941,756,028TGTCGGCTCATCGCATGAAG
TUP41,756,03241,756,054CCCTGGCAAGGACAAGTGGAGCC
TUR41,756,13141,756,151TGGCTGTGTATTCGGGCTTAC
TDF41,758,40741,758,430CCCATAAGCCCTCCTCAGTATTTC
TDP41,758,43641,758,460CCCAGAACGCCTCGGTACAATTCCA
TDR41,758,48541,758,507GCGGCCTATAAAGGGACAAGAAG

PCR Primers

PrimerSequence
SUCGGTGTGCAGGAGAATCATC
SDTCAAAGTCCGTAGGCAAGAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR143 bp++-
TDFTDR101 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++